دانشگاه شهید چمران اهوازگیاه پزشکی2588-593642120190421Effects of single and simultaneous application of the parasitoid, Lysiphlebus fabarum and the ladybird beetle, Hippodamia variegata on control of Aphis gossypii on cucumberتأثیر کاربرد جداگانه و توأم زنبور پارازیتوئید Lysiphlebus fabarum و کفشدوزک شکارگر Hippodamia variegata، در کنترل شته جالیز Aphis gossypii روی خیار1171423810.22055/ppr.2019.14238FAزهرامحمدیدانشجوی دکترای تخصصی دانشگاه شهید چمران اهوازآرشراسخدانشیار دانشگاه شهید چمران اهوازمهدیاسفندیاریدانشیار دانشگاه شهید چمران اهوازجان پاولمیکائوداستاد دانشگاه ایالتی کانزاسفرحانکچیلیدانشیار دانشگاه شهید چمران اهوازJournal Article20191205<strong>Background and objectives</strong> <br />The cotton aphid, <em>Aphis gossypii</em>, is an important pest on greenhouse crops such as the cucumber. Natural enemies have often been used successfully to control greenhouse pests. Among different pests, aphids because of their high reproductive rate are particularly difficult to control biologically. <br /><strong>Materials and Methods</strong> <br />In this study, the effects of separate and simultaneous application of the parasitoid wasp <em>Lysiphlebus fabarum</em> and the predator ladybird beetle <em>Hippodamia variegata</em> were studied to control <em>A. gossypii</em> on cucumber as an integrated pest management program. The replicates (n= 10) in all treatments included 10 cucumber plants in separate pots and were infected with five winged <em>A. gossypii</em> placed in a cage with a banker plant system of <em>Vicia fabae-Aphis fabae</em>. With the introduction of mummified aphids on a bean shoot (every two days), a pair of male and female adult ladybird beetles (every three days) or simultaneous application of both biocontrol agents, the numbers of aphids were counted in the three treatments. <br /><strong>Results</strong> <br />The results revealed that the parasitoid wasp <em>L. fabarum</em> alone was unable to control <em>A. gossypii</em>, but <em>H. variegata</em> performed better. The best performance was observed for simultaneous application of both biocontrol agents. Moreover, in the combined agents’ treatment, the number of <em>A. gossypii</em> on the both lower and upper cucumber leaves was not significantly different compare to other treatments that biological agentswere used seperatly. The number of mummified aphids did not differ between treatments at the end of the experiments. This is indicative of the tendency for ladybird beetles to feed on different growth stages of non-parasitized aphids compare to parasitized aphids containing immature stages of <em>L. fabarum</em>. <br /><strong>Discussion</strong> <br />The results indicate thatthe simultaneous application of both biocontrol agents is effective for the control of <em>A. gossypii</em>, although more research under greenhouse condition is needed.شته جالیز <em>Aphis gossypii</em> یکی از آفات مهم گیاهان گلخانهای از جمله خیار میباشد. در مطالعهی حاضر تأثیر کاربرد جداگانه و توأم زنبور پارازیتوئید <em>Lysiphlebus fabarum</em> و کفشدوزک <em>Hippodamia variegata</em> به منظور کنترل این شته مورد ارزیابی قرار گرفت. تکرارها در کلیهی تیمارها شامل 10 عدد گیاه خیار بود که هر کدام به پنج شتهی بالدار آلوده شدند و همراه با یک گیاه حامل "باقلا-شته سیاه باقلا" در یک قفس قرار گرفتند. در ادامه با معرفی مرتب یک شاخه باقلا، محتوی شتههای مومیایی شده (دو روز در میان)، یک جفت حشره کامل نر و ماده کفشدوزک (سه روز در میان) و یا کاربرد همزمان هر دوی این عوامل، تغییرات جمعیت شته جالیز طی هفت هفته در سه تیمار بررسی شد. بر اساس نتایج بدست آمده، زنبور به تنهایی قادر به تنظیم جمعیت شته جالیز نبود، اما کفشدوزک <em>H. variegata</em>، عملکرد به مراتب بهتری از خود نشان داد. بهترین عملکرد هنگام کاربرد توأم زنبور و کفشدوزک بدست آمد به گونهای که اوج جمعیت شته بطور معنیداری تعدیل شد و همچنین تعداد شتههای زنده در پایان آزمایش در این تیمار (7/9±145) در مقایسه با کاربرد جداگانه زنبور (7/26±357) و یا کفشدوزک (9/6±189) بطور معنیداری کمتر بود. همچنین در خصوص تعداد مومیاییها در پایان آزمایش اختلاف معنیداری بین تیمارها (کاربرد جداگانه زنبور: 9/22±145؛ کاربرد توأم: 8/11±177) مشاهده نشدکه نشاندهندهی عدم تمایل مراحل مختلف رشدی کفشدوزک <em>H. variegata</em>در تغذیه از مراحل نابالغ زنبور <em>L. fabarum</em> میباشد. در یک جمعبندیکاربرد همزمان این دو عامل کنترل زیستی در مهار شته جالیز مؤثر بنظر میرسد.دانشگاه شهید چمران اهوازگیاه پزشکی2588-593642120190421Bioecology of wheat chafers Miltotrogus caucasicus and Tanyproctus ganglbaueri in the western Iranبیواکولوژی سوسکهای قهوهای گندم Miltotrogus caucasicus و Tanyproctus ganglbaueri در غرب ایران19311428710.22055/ppr.2019.14287FAهاناحاجی اللهوردی پوربخش تحقیقات کنترل بیولوژیک، موسسه تحقیقات گیاهپزشکی کشورشهلاباقری متینبخش گیاهپزشکی، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان کرمانشاهمهرانغزویبخش تحقیقات کنترل بیولوژیک، موسسه تحقیقات گیاهپزشکی کشورJournal Article20181103<strong>Background and Objectives</strong> <br />Large areas of non-irrigated wheat fields have recently gone through the damage caused by growing population of wheat chafers. To study wheat chafers’ population changes and their natural enemies, the larvae, pupae and adults were collected from Kermanshah and Kurdistan provinces. <br /><strong>Materials and Methods</strong> <br />Sampling and counting of larvae and pupae were done by placing wooden quadrats over the wheat fields and digging soils of the sampled areas. The insect net was employed to capture the adults. The sampling was carried out for three years (2010-2013). <br /><strong>Results</strong> <br />The two cockchafer species <em>Tanyproctus ganglbaueri</em> and <em>Miltotrogus</em> (<em>Amphimallon</em>) <em>caucasicus</em> (Scarabaeidae) were the most damaging chafers to wheat in western parts of Iran. The dominant species depended on the region and timespan indicating species turnover. The described species of <em>T. ganglbaueri</em> hasn’t been reported yet as a pest worldwide. The highest density of <em>M.</em> <em>caucasicus</em> larvae in Kermanshah province was 5.6 larvae per 0.25 m<sup>2</sup> quadrat in mid-April; while in case of <em>T. ganglbaueri</em> 16 larvae per 0.25 m<sup>2</sup> quadrat was recorded in March in Kurdistan province. Larvae of <em>T. ganglbaueri</em> started feeding in early February and the peak feeding times occured in March and April. The average adult lifespan of <em>T. ganglbaueri</em> was roughly 43 days. Fungal and bacterial pathogens including <em>Beauveria bassiana</em>, <em>Hirsutella</em> sp. and <em>Bacillus</em> sp. were isolated from the wheat chafers. <br /><strong>Discussion</strong> <br />The relatively different biology of these two pest species has an implication in their timing control actions. More studies on identification and revision of wheat scarabs in different climates of Iran is needed. <br /><strong><em> </em></strong>در سالهای اخیر بخشهای وسیعی از مزارع گندم دیم شاهد خسارت ناشی از جمعیت در حال افزایش سوسکهای قهوهای گندم شده است. به منظور مطالعه تغییرات جمعیتی و عوامل محدود کننده طبیعی فعالیت سوسکهای قهوهای گندم، لاروها، شفیرهها و حشرات کامل این آفت از مزارع گندم دیم استانهای کرمانشاه و کردستان جمعآوری گردید. جمعآوری و شمارش لاروها و شفیرهها با انداختن کادرهای چوبی در سطح مزرعه و کندن خاک آن محدوده انجام گرفت. برای شکار حشرات کامل آفت در مزارع اقدام به تور زدن گردید. نتایج بررسیهای سه ساله نشان داد که سوسکهای قهوهای گندم در غرب ایران عمدتاً شامل گونههای Brenske, 1897)<em> </em><em>Tanyproctus ganglbaueri) </em>و Gyllenhal,1817) <em>Miltotrogus </em>(<em>Amphimallon</em>)<em> caucasicus)</em> و متعلق به خانواده Scarabaeidae بودند. گونه غالب بسته به منطقه و سال زراعی متفاوت بود و گونهها به نوعی جایگزین یکدیگر شدند. خسارت قابل توجه گونه <em>T. ganglbaueri</em> به عنوان آفت قبل از این در دنیا گزارش نشده است. بیشترین میانگین تراکم لاروهای <em>M. caucasicus</em> در استان کرمانشاه 6/5 عدد در هر کادر 25/0 مترمربع در دهه اول دی ماه دیده شد. بیشترین تراکم لاروهای <em>T. ganglbaueri</em> در کردستان 16 عدد لارو در هر کادر در فروردین ماه ثبت شد. لاروهای <em>T. ganglbaueri</em> ازاواخر بهمن ماه شروع به تغذیه کرده و شدت تغذیه لاروها در اسفند و فروردین ماه بود. متوسط طول عمر حشره کامل <em>T. ganglbaueri</em> حدود 43 روز بود. زیستشناسی تا حدودی متفاوت این دو گونه آفت در انتخاب بهترین زمان کنترل آنها اهمیت دارد. گونههایی از قارچها شامل <em>Beauveria bassiana</em> و <em>Hirsutella </em>sp. و باکتریهای بیمارگر حشرات مانند <em>Bacillus </em>sp.از سوسکهای قهوهای گندم جداسازی شد. نیاز به مطالعات بیشتر برای شناسایی و بازنگری گونه های سوسکهای قهوهای گندم در اقلیم های مختلف ایران وجود دارد.دانشگاه شهید چمران اهوازگیاه پزشکی2588-593642120190421Effect of coconut oil soap and red pepper extract as compared to propargite acaricide on fig mite, Eotetranychus hirsti Baker & Pritchard, under field conditionsتاثیر صابون روغن نارگیل و عصاره فرآوریشده فلفل قرمز در مقایسه با کنهکش پروپارژیت روی کنه انجیر،Eotetranychus hirsti Baker & Pritchard، در شرایط صحرایی33431441910.22055/ppr.2019.14419FAمرضیهمحمودیدانش آموخته داﻧﺸﮕﺎه ﻋﻠﻢ و ﻓﺮﻫﻨﮓ شعبه ﻛﺎﺷﻤﺮحسینفرازمنددانشیار ﻣﻮﺳﺴﻪ ﺗﺤﻘﻴﻘﺎت ﮔﻴﺎهﭘﺰﺷﻜﻲ کشورعیسیجبلهمربی، دانشگاه علم و فرهنگ شعبه کاشمرمحمدسیرجانیمربی، ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت و آﻣﻮزش ﻛﺸﺎورزی و ﻣﻨﺎﺑﻊ ﻃﺒﻴﻌﻲ ﺧﺮاﺳﺎن رﺿﻮی، شعبه ﻛﺎﺷﻤﺮJournal Article20190321<strong>Background and Objectives</strong> <br />Fig mite, <em>Eotetranychus hirsti</em> Baker & Pritchard (Acari: Tetranychidae), is one of the most important pests of fig trees in Iran and most parts of the world. This pest causes the leaves to fall and reduce the quantity and quality of the product. Several different insecticides have been used to control this mite. <br /><strong>Materials and Methods</strong> <br />Due to the consumption of fresh fig and in order to produce healthy crops and to develop non-chemical pesticides, the application of coconut botanical soap (Palizin<sup>®</sup> SL70%), red pepper extract (Tondexir<sup>®</sup> EC85%), and propargite (Omite<sup>®</sup>, EC57%,) were tested in the fields of Bardaskan region, during 2015-2016. The botanical insecticides (1500 & 2000 ppm concentrations), propargite acaricide (2000 ppm) and water were sprayed over the whole canopy during July to August. Samplings were carried out one day before and 3, 7, 14, 21 and 28 days after spraying. At each sampling time, the total number of egg, larvae and active stages (nymph and imago) of fig mite on 4 leaves per tree were counted. Treatments were compared based on mortality rate and efficacy percentage. Data was analyzed based on a completely block randomized design using SAS software. Mean comparison was done using Tukey's test. <br /><strong>Results</strong> <br />The results of this study showed that there was a significant difference between all treatments and different times, on all developmental stages of fig mite. Based on the field studies, the application of botanical components, including the red pepper extract, compared with the propargite acaricide, caused a further decrease in the population of fig mites. The highest mortality rates for eggs, larvae and active stages (nymph and imago) of fig mite were observed in red pepper extract and coconut botanical soap treatments, and the lowest mortality rates was recorded in control treatment. The mean efficacy percentage of red pepper extract (2000 ppm) treatment for eggs, larvae and active stages (nymph and imago) were 97.9, 95.1, 92.2 in 3 days, 98.7, 94.2, 93.5 in 7 days, 96.0, 88.9, 89.3 in 14 days, 98.8, 93.7, 92.8 in 21 days and 97.1, 96.8 and 92.7 in 28 days after spraying, respectively. Also, the mean efficacy percentage of coconut botanical soap (2000 ppm) treatment for egg, larvae and active stages (nymph and imago) were 88.9, 89.2, 87.0 in 3 days, 89.2, 87.7, 86.3 in 7 days, 87.1, 86.0, 87.6 in 14 days, 86.6, 83.5, 83.4 in 21 days and 87.5, 87.6 and 90.9 in 28 days after spraying, respectively. <br /><strong>Discussion</strong> <br />Therefore, red pepper extract (Tondexir<sup>®</sup>) spraying with 2000 ppm concentration, over the whole canopy of figs trees, were effective in decreasing fig mite damage.کنه تارتن انجیر، Acari:(Tetranychidae) <em>Eotetranychus hirsti</em> Baker & Pritchard یکی از مهمترین آفات درختان انجیر در اﯾﺮان و ﺑﺴﯿﺎری از ﻣﻨﺎﻃﻖ ﺟﻬﺎن ﻣﯽﺑﺎﺷﺪ. این آفت موجب ریزش برگ ها شده و خسارت قابل توجهی به بار میآورد. به طوری که کشاورزان هر ساله برای کنترل جمعیت این آفت از سموم شیمیایی مختلفی استفاده میکنند. با توجه به مصرف تازهخوری میوه انجیر و در راستای تولید محصول سالم و توسعه مصرف آفتکشهای غیرشیمیایی، تأثیر غلظت های 1500 و 2000 پی پی ام آفت کش حاوی صابون روغن نارگیل (پالیزین<sup>®</sup>)، عصاره فرآوری شده فلفل قرمز (تنداکسیر<sup>®</sup>)، کنه کش پروپارژیت (اومایت<sup>®</sup>) با غلظت 1000 پی پی ام، آبپاشی و شاهد (بدون محلولپاشی) در شهرستان بردسکن، در سال های 1394 و 1395 انجام شد. محلول پاشیدر هر سال در اوایل مرداد اجرا و نمونه برداری از برگ در زمان های یک روز قبل از محلولپاشی و 3، 7، 14، 21 و 28 روز بعد از محلولپاشی انجام شد. نتایج حاصل از این پژوهش نشان داد که از نظر مرگ و میر مراحل مختلف زیستی کنه تارتن انجیر، بین تیمارهای مورد آزمایش و در زمان های مختلف اختلاف معنیداری وجود داشت. بر اساس نتایج بدست آمده، کاربرد ترکیبات گیاهی از جمله عصاره فرآوری شده فلفل قرمز در مقایسه با کنه کش پروپارژیت به طور معنی داری موجب کاهش بیشتر جمعیت کنه انجیر شد.همچنین میانگین درصد تلفات تیمار عصاره فرآوری شده فلفل قرمز، روی مراحل مختلف رشدی آفت شامل تخم، لارو و مرحله پوره و بالغ، در زمان 3 روز بعد از محلول پاشی به ترتیب، 0/99، 1/98 و 2/90 درصد در سال اول و 0/98، 4/94 و 2/96 درصد در سال دوم بود و در زمان 28 روز پس از محلول پاشی به ترتیب، 9/97، 6/97 و 6/91 درصد در سال اول و 4/98، 7/97 و 3/97 درصد در سال دوم بدست آمد. بر اساس نتایج تحقیق حاضر، محلول پاشی درختان انجیر با حشره کش حاوی عصاره فرآوری شده فلفل قرمز (تنداکسیر<sup>®</sup>)، با غلظت 2000 پی پی ام، برای کنترل خسارت کنه انجیر می تواند توصیه شود.دانشگاه شهید چمران اهوازگیاه پزشکی2588-593642120190421Lethal and sublethal effects of botanical insecticide, tondexir (Tondexir®) and chemical insecticide, indoxacarb (Avaunt®) on the tomato leaf miner, Tuta absoluta (Meyrick) (Lep.: Gelechiidae)اثرات کشندگی و زیرکشندگی حشرهکش گیاهی تنداکسیر Tondexir® و حشرهکش شیمیایی ایندوکساکارب Avaunt® روی شبپره مینوز گوجهفرنگی (Lep.: Gelechiidae) Meyrick Tuta absoluta46631444310.22055/ppr.2019.14443FAمهدیکبیری رئیسآباددانشجوی دکتری حشرهشناسی، دانشگاه محقق اردبیلیJournal Article20190321<strong>Background and Objectives</strong> <br />The tomato leaf miner, <em>Tuta absoluta</em> (Meyrick) is the most damaging tomato insect pest. In the present study, the lethal effects of plant insecticide, tondexir (Tondexir<sup>®</sup>) and chemical insecticide, indoxacarb (Avaunt<sup>®</sup>) were assessed against<em> T. absoluta</em> under laboratory and field conditions. <br /><strong>Materials and Methods</strong> <br />The sublethal (LC<sub>30</sub>) effects of the insecticides were evaluated on the life table parameters of <em>T. absoluta</em>. The potter tower was used for the bioassays. In order to define the effect of these compounds, an experimental field was carried out in a randomized complete block design with three treatments replicated four times during two consecutive seasons in 2017 and 2018. <br /><strong>Results</strong> <br />The LC<sub>50</sub>values of tondexir and indoxacarb on eggs of <em>T. absoluta</em> were 837.9 and 1139.1 ppm, respectively. Sublethal concentration of insecticides affected life table parameters of <em>T. absoluta</em> significantly. Embryonic, larval, pupal and TPOP periods were significantly higher in tondexir than the control. <em>Intrinsic rate of increase (</em><em>r<sub>m</sub></em><em>) value in both insecticides treatments was significantly lower than control (P</em><em><</em><em>0.05). The minimum value of </em><em>λ</em><em> (1.105 day<sup>-1</sup>) and the longest generation time (39.36 day) was observed in tondexir. </em>The persistency effect of tested insecticides under field conditions was higher in tondexir than indoxacarb. Even 21 days after treatment, the percentage mortality of eggs and larvae of <em>T. absoluta</em> were significantly higher in plot that treated with tondexir than indoxacarb treatment. <br /><strong>Discussion</strong> <br />The total results revealed that tondexir had high lethal and sublethal effects on tomato leafminer and can be recommendable to be applied in an integrated pest management program (IPM) of this pest.شبپره مینوز گوجهفرنگیMeyrick <em>Tuta absoluta</em> آفت مهم و کلیدی گوجهفرنگی میباشد. در بررسی حاضر ابتدا اثرات کشندگی حشرهکش گیاهی تنداکسیر (Tondexir<sup>®</sup>) و حشرهکش شیمیایی ایندوکساکارب (Avaunt<sup>®</sup>) روی تخم این آفت مورد بررسی قرار گرفت. در آزمایش دیگری اثرات غلظت زیرکشنده (LC<sub>30</sub>) دو ترکیب ذکر شده روی پارارمترهای جدول زندگی این آفت بررسی شد. از دستگاه برج پاشش (Potter tower) برای زیست سنجیها استفاده شد.همچنین به منظور بررسی تاثیر ترکیبات ذکر شده در شرایط مزرعهای، آزمایشی با سه تیمار و چهار تکرار در قالب طرح بلوک کامل تصادفی طی دو سال زراعی 1396 و 1397 انجام شد. در شرایط آزمایشگاهی حشرهکش تنداکسیر سمیت بالاتری نسبت به ایندوکساکارب برای تخم <em>T. absoluta</em> داشت. میزان LC<sub>50</sub> ترکیبات ذکر شده به ترتیب 9/837 پیپیام و 1/1139 پیپیام برآورد شد. غلظت زیرکشنده ترکیبات ذکر شده به طور معنیداری آمارههای جدول زندگی این آفت را تحت تاثیر قرار دادند. طول دورههای جنینی، لاروی، شفیرگی و طول کل دوره پیش از تخمگذاری (TPOP) در تیمار تنداکسیر به طور معنیداری بالاتر از تیمار شاهد بود. نرخ ذاتی افزایش جمعیت (<em>r<sub>m</sub></em>) در تیمار حشرهکشها به طور معنیداری پایینتر از تیمار شاهد بود (P<0.05). کمترین میزان نرخ متناهی افزایش جمعیت (<em>λ</em>) (105/1 بر روز) و طولانیترین طول دوره یک نسل (<em>T</em>) (36/39 روز) در تیمار تنداکسیر مشاهده شد. در شرایط مزرعهای دوام اثر حشرهکشی تنداکسیر بالاتر از ایندوکساکارب بود، چنانچه در نمونهبرداریهای بیستویک روز پس از تیمار، درصد تلفات ایجاد شدهدر تخم و لارو مینوز گوجهفرنگی در قطعات تیمار شده با این حشرهکش به طور معنیداری بالاتر از قطعات تیمار شده با ایندوکساکارب بود. نتایج به طور کلی نشان داد حشرهکش گیاهی تنداکسیر اثرات کشندگی و زیرکشندگی بالایی برای مینوز گوجهفرنگی دارد و میتواند به عنوان یکی از گزینههای احتمالی در برنامه مدیریت تلفیقی این آفت (IPM) مطرح باشد.دانشگاه شهید چمران اهوازگیاه پزشکی2588-593642120190421Assessment of reaction to Cereal cyst nematodes (Heterodear filipjevi) to different bread wheat accessions under greenhouse conditionsارزیابی واکنش ژنوتیپهای مختلف گندم نان نسبت به نماتد سیستی غلات (Heterodera filipjevi) در شرایط گلخانه65771445810.22055/ppr.2019.14458FAهادیکریمی پور فرداستادیار پژوهش مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان کهگیلویه و بویراحمد0000-0001-7625-4822ابراهیمپورجماستاد دانشگاه تربیت مدسزهراتنها معافیاستاد پژوهش موسسه تحقیقات گیاهپزشکی کشورناصرصفاییدانشیار، دانشگاه تربیت مدسJournal Article20180808<strong>Background and Objectives</strong> <br />Cereal cyst nematodes (CCNs) are acknowledged globally as a biotic constraint for wheat production, particularly under rain-fed conditions and drought stress. Among species of CCNs, <em>Heterodear filipjevi </em>is the dominant species in most cereal growing areas of Iran and is widespread in different regions of the country. The use of resistant wheat cultivars is considered the most effective and economical method for managing cereal cyst nematodes. The effectiveness of resistance to CCNs depends on the efficiency and durability of the sources of resistance, and on the correct identification of the nematode species and pathotype(s) present in each region. The objective of this study was to assess the reaction of common accessions of bread wheat to <em>H. filipjevi</em> under greenhouse conditions. <br /><strong>Materials and Methods</strong> <br />The reaction of common accessions of bread wheat, including some cultivars and lines (20 accessions) to <em>H. filipjevi</em> was assessed according to used method for screening of wheat accessions under controlled conditions. Single wheat seeds were planted in standard small tubes. After plant emergence, tubes were inoculated with 300 freshly hatched J2 in 3 holes around the stem base. Experimental units were arranged in a randomized complete block design with 5 replicates. Plants were harvested 8 weeks after juvenile inoculation. Extracted Cysts from both root and soil counted under a stereomicroscope. The data were analyzed and the genotypes were divided into different groups based on their reactions. <br /><strong>Results</strong> <br />The results showed that Back-cross Rowshan cultivar with mean 30.2 and Silverstar cultivar with mean 6.8 had the most and the least number of cysts in soil and root of each plant, respectively. Cluster analysis divided all accessions into 4 groups. Back-cross Rowshan, Pishtaz and Pishgam cultivars were identified as highly susceptible according to higher mean of the cyst number in soil and root, in comparison to Bezostaya cultivar (Susceptible check). Mahdavi, Bam, Dena, Bahar, Sivand, Ofogh, Arg and Bezostaya cultivars were categorized as susceptible. Rowshan, Alvand, Parsi, Es-93-95 and Marvdasht accessions were grouped as moderately susceptible, and, Sirvan, M-90-9, M-90-7 and Silverstar (Moderately resistant check) accessions were identified as moderately resistant. <br /><strong>Discussion</strong> <br />This study revealed that Back-cross Rowshan, Pishtaz and Pishgam are highly susceptible cultivars to <em>H. filipjevi</em>. However, the cultivation of these wheat cultivars is common in the country. In order to impeding the damage of this nematode, it is essential to avoid cultivating these cultivars and other susceptible cultivars in infested fields to <em>H. filipjevi</em>.نماتدهای سیستی غلات یکی از عوامل زنده تهدیدکننده تولید گندم مخصوصاً در شرایط دیم و استرسهای ناشی از خشکی در بیشتر کشورهای تولیدکننده گندم در جهان به شمار می روند. از بین گونههای نماتد سیستی غلات، <em>Heterodera filipjevi </em> گونه غالب و شایع در مزارع غلات ایران است. در این مطالعه واکنش ژنوتیپهای رایج گندم نان شامل چندین رقم و لاین نسبت به <em>H. filipjevi</em> در شرایط گلخانه، برمبنای روش ارایه شده جهت غربالگری ژنوتیپ های گندم تحت شرایط کنترل شده، مورد ارزیابی قرار گرفت. نتایج نشان داد ارقام بک کراس روشن با میانگین جمعیت 2/30 و سیلور استار با میانگین جمعیت 8/6 سیست و ماده بالغ، به ترتیب بیشترین و کمترین میانگین جمعیت را به خود اختصاص دادند. تجزیه خوشه ای داده ها، کلیه ژنوتیپ ها را در چهار گروه تقسیمبندی نمود. سه رقم بک کراس روشن، پیشتاز و پیشگام با توجه به بالاتر بودن میانگین تعداد سیستهای موجود در خاک و ریشه نسبت به رقم حساس بزوستایا (شاهد حساس) به عنوان ژنوتیپ های بسیار حساس (HS) گروه بندی شدند. ارقام مهدوی، بم، دنا، بهار، سیوند، افق، ارگ و بزوستایا در گروه ژنوتیپ های حساس (S) قرار گرفتند. ژنوتیپ های روشن، الوند، پارسی، ES-93-95 و مرودشت به عنوان ژنوتیپ های نسبتاً حساس (MS) و ژنوتیپ های سیروان، M-90-9 و M-90-7 به همراه ژنوتیپ سیلور استار (شاهد نسبتاً مقاوم)، در گروه ژنوتیپ های نسبتاً مقاوم (MR) قرار گرفتند.دانشگاه شهید چمران اهوازگیاه پزشکی2588-593642120190421Silencing of CYP6CM1 gene of cotton whitefly Bemisia tabaci (Gennadius) using RNAi techniqueخاموشی ژن سم زدای CYP6CM1 در سفیدبالک پنبه (.Gennadius) Bemisia tabaci با استفاده از تکنیک RNAi79891447110.22055/ppr.2019.14471FAمسلمبسیجاستادیار دانشگاه جیرفتخلیلطالبیاستاد دانشگاه تهرانوحیدحسینی نوهدانشیار دانشگاه تهرانسید علیرضاسلامیاستادیار دانشگاه تهرانJournal Article20181120<strong>Background and Objectives</strong> <br />The cotton whitefly, <em>Bemisia tabaci</em> (Gennadius) (Hemiptera: Aleyrodidae), is a significant agricultural pest in arable lands and on ornamental crops in temperate regions of the world and has been shown to be capable of developing resistance to many classes of insecticides. Difficulties in controlling <em>B. tabaci</em> mainly result from its resistance to insecticides, including neonicotinoids. Neonicotinoids are a relatively new class of synthetic insecticides used primarily to control of whiteflies, <em>B. tabaci</em> is capable of developing resistance to different classes of insecticides as neonicotinoides. It has been experimentally proven that resistance of <em>B. tabaci</em> to imidacloprid is associated with overexpression of the P450 genes. RNA interference (RNAi) has been successfully applied in insects to study RNAi mechanisms and gene functions. In this study, the RNA interference (RNAi) effects of P450 CYP6CM1 as key gene in resistance to neonicotinoides on expression, resistance ratio and total P450 activities were evaluated. <br /><strong>Material and Methods</strong> <br />Colony of whitefly reared on leaves of tomato plants in growth chamber at 25 ± 2 ºC, 65±5% RH and a photoperiod 16:8 h (light: darkness). Total RNA was isolated from adult <em>B. tabaci</em> using Biosol reagent (Invitrogen). cDNA synthesis was performed using iScript cDNA Synthesis Kit (BIO-RAD). Double-stranded RNA (dsRNA) of P450 <em>CYP6CM1 </em>was synthesized using specific primers (3' TAATACGACTCACTATAGGG 5', 3' TAATACGACTCACTATAGGG 5'), the bioassay tests after introduce of dsRNA into the insect body of whitefly by oral delivery were carried out for 6 days, and mortality was recorded daily by counting the dead insects at the bottom of the tube. The LC50 and resistance ratio were calculated using Ploplus computer software. The amount of cytochrome P450 activity was measured using 7-ethoxycoumarin based on the microfluorimetric method. Quantification of mRNA expression levels was quantified using the comparative cross-threshold (CT) (the PCR cycle number that crosses the signal threshold) method. <br /><strong>Results</strong> <br />Analysis of knockdown effects of CYP6CM1 on resistance was based on probit analysis and indicates that the gene is responsible for up to 5.3-fold reduction in imidacloprid resistance of dsRNA-fed adults. Moderate, but significant reduction in total P450 activity (45 %) exhibited by microsomal proteins prepared from dsRNA-fed JR population adult when compared to the control (JR population without dsRNA-fed). The results of P450 CYP6CM1 mRNA expression levels showed decrease in mRNA levels of the target genes with increasing the time after feeding dsRNA. Results revealed that delivery dsRNA to adult insect's reduced CYP6CM1 expression up to 2 -fold when comparing to the control. <br /><strong>Discussion</strong> <br />Reduction in resistance ratio by 5.3 fold after CYP6CM1 dsRNA fed in resistance population indicated the possibility of practical use of RNAi technique in insect resistance management (IRM). سفیدبالک (Gennadius.)<em>Bemisia</em> <em>tabaci</em> یکی از مهمترین آفات گیاهان زراعی و محصولات زینتی در جهان است و مشاهده شده است که قابلیت مقاوم شدن به بسیاری از گرو ههای حشرهکشها را دارد. این آفت توانایی بروز مقاومت به گروههای مختلف حشرهکش از جمله نئونیکوتونوئیدها را دارا میباشد.در مطالعهی حاضر تاثیر استفاده از تکنیک خاموشی ژن (RNAi) ژن CYP6CM1 به عنوان یکی از اصلیترین ژنهای مسئول بروز مقاومت به نئونیکوتینوئیدها روی سطح نسبی بیان، اندازه مقاومت و میزان فعالیت آنزیم سیتوکروم P450 در دو جمعیت سفیدبالک پنبه مقاوم و حساس در برابر حشرهکش ایمیداکلوپرید مورد ارزیابی قرار گرفت.کلنی جمعیتهای سفیدبالک پنبه روی برگهای گیاه گوجه و در اتاقک رشد پرورش یافت. RNA دو رشتهای ژن CYP6CM1 با استفاده از پرایمرهای اختصاصی سنتز شد و آزمایشات زیستسنجی پس از وارد کردن dsRNA به داخل بدن حشره از طرق دریافت دهانی و با محاسبه مقدار LC50 و نسبت مقاومت با استفاده از نرم افزار کامپیوتری Ploplus انجام شد. اندازهگیری فعالیت مونواکسیژناز نیز با استفاده از زیر نهشت 7- اتوکسی کومارین انجام شد. آنالیز دادهها نشان داد که تغذیه دهانیdsRNA به طور موثری میزان سطح بیان نسبی ژن CYP6CM1 (2 برابری)، اندازه مقاومت (3/5 برابری) و میزان فعالیت آنزیم سیتوکرومP450 (45 درصدی) را در جمعیت مقاوم تغذیهشده باCYP6CM1dsRNA کاهش داد. کاهش چند برابری اندازه مقاومت بیانگر امکان استفاده عملی از تکنیکRNAi در مدیریت مقاومت <em>B</em>. <em>tabaci</em> میباشد.دانشگاه شهید چمران اهوازگیاه پزشکی2588-593642120190421The investigation of the effect of garlic and thyme extracts on orange green mold (Penicillium digitatum), defense enzymes and genes expressionبررسی تأثیر عصارههای سیر و آویشن شیرازی بر روی بیماری کپک سبز (Penicillium digitatum) و بعضی از مکانیسمهای دفاعی در پرتقال911181449510.22055/ppr.2019.14495FAجلالغلامنژاداستادیار دانشگاه اردکانشکیباارسلانیدانشجوی کارشناسیارشد دانشگاه آزاد اسلامی واحد ورامینمژدهملکیاستادیار دانشگاه آزاد اسلامی واحد ورامینJournal Article20171205<strong>Background and Objectives</strong> <br />The use of chemical pesticides has caused environmental hazards as well as the creation of residues on food products. In this research, the extracts of <em>Zataria multiflora</em>Boiss<em>.</em> and Garlic (<em>Allium</em> <em>sativum</em> L.) were used for controlling the green mold of orange caused by <em>Penicillium digitatum</em>, <em>invitro</em> and <em>invivo</em> at 15 ̊C. <br /><strong>Materials and Methods</strong> <br />In this study, the effect of plant extracts against the pathogen was evaluated using two methods, included the paper disc and mixing with culture media. Then, the effect of these extracts on the fruit was studied against the pathogen. The level of activity of the enzymes including peroxidase, catalase and polyphenol oxidase, as well as total phenol content were measured. Finally, the expression of catalase, peroxidase and polyphenol oxidase genes was evaluated using the Real time PCR method. <br /><strong>Results</strong> <br />The results of disc test showed that aqueous and alcoholic extracts of garlic had the highest effect on fungal mycelium growth with 60 mg at ml concentration and 32.20 mm and 26.12 mm diameter of inhibition zone respectively. The mixing culture test showed that aqueous and alcoholic extracts of garlic with 65.25 and 75.26 percent of the inhibitory effect on the pathogen, respectively, showed the best control compared to the control in 600 mg at L concentration. The results of <em>invivo</em> assays indicated that 6×1000 concentration of aqueous and alcoholic garlic and thyme extracts had the lowest of decay area with 5.3 and 3.26 cm<sup>2</sup> respectively (for garlic) and 7.44 and 4.15 cm<sup>2 </sup>for thyme. Results of enzyme activity of peroxidase and polyphenol oxidase showed that the highest activity of both enzymes was 9 days after sampling and in the treatment of 6×1000 garlic extract. <br /><strong>Discussion</strong> <br />Based on the results of laboratory and storage tests, the extract of both garlic and thyme are introduced as natural constituents with controlled potentials. The genes expression levels of enzymes as peroxidase, polyphenol oxidase, and phenylalanine ammonialis had the same trend to the activity of two enzymes over a period of 12 days. Based on the results of <em>invivo</em> and <em>invitro</em> tests, the extract of garlic and thyme are introduced as natural compounds with high controlling potentials. استفاده از سموم شیمیایی در طی دهه ها باعث ایجاد آلودگی محیط زیست و همچنین ایجاد باقیمانده بر روی محصولات غذایی شده است. در این پژوهش از عصاره های آبی و متانولی آویشن شیرازی (<em>Zataria multiflora </em>Boiss.) و سیر (<em>Allium sativum</em> L.)جهت کنترل بیماری کپک سبز پرتقال با عامل .<em>Penicillium digitatum </em>Sacc، در آزمایشگاه و در انبار 15 درجه سلسیوس استفاده شد. نتایح آزمون دیسک گذاری در محیط کشت نشان داد که، عصارۀ آبی و الکلی سیر (غلظت 60 میلی گرم در میلی لیتر)با 26 و 32 میلیمتر قطر ممانعت از قارچ بیمارگر، دارای بیشترین اثر کنترل کنندگی و عصارۀ آبی و الکلی آویشن شیرازی (غلظت 15 میلی گرم در میلی لیتر) با 10 و 14 میلی متر قطر ممانعت از قارچ بیمارگر، دارای کمترین اثر کنترل کنندگی بود. در آزمون اختلاط با محیط کشت، عصاره های آبی و الکلی سیر در غلظت 600 میلی گرم در لیتر به ترتیب با 25/65 و 26/75 درصد ممانعت از قارچ بیمارگر بهترین کنترل کنندگی بیمارگر را نشان دادند. در آزمون انبار 15 درجۀ سلسیوس، سطح لکۀ ایجاد شده در تیمار عصاره های آبی و الکلی سیر و آویشن شیرازی با غلظت شش در هزار، cm<sup>2</sup> 30/5 (آبی) و cm<sup>2</sup>26/3 (الکلی) برای سیر، cm<sup>2</sup> 44/7 (آبی) و cm<sup>2</sup>15/4 (الکلی) برای آویشن شیرازی، کمترین میزان خود را در مقایسه با سایر تیمارها وهمچنین تیمار شاهد (با میزان cm<sup>2</sup>47/30) داشتند. نتایج بررسی فعالیت آنزیم های پراکسیداز و پلی فنل اکسیداز نشان داد که بیشترین فعالیت هر دو آنزیم نه روز بعد از نمونه برداری و در تیمار شش در هزار عصارۀ سیر مشاهده شد. میزان نسخه برداری سه ژن کدکنندۀ آنزیم های پراکسیداز، پلی فنل اکسیداز و فنیل آلانین آمونیالیاز روندی مانند میزان فعالیت سه آنزیم در طول 12 روز نمونه برداری داشت و در روز نهم، بیشترین میزان نسخه برداری این سه آنزیم به ترتیب با مقدار عددی 23/15، 80/11 و 36/12 برابر شاهد سالم بودند. بر اساس نتایج آزمون های آزمایشگاهی و انباری، عصارۀ هر دو گیاه سیر و آویشن شیرازی به عنوان ترکیبات طبیعی با پتانسیل کنترل کنندگی معرفی می شوند.