خاموشی ژن سم زدای CYP6CM1 در سفیدبالک پنبه (.Gennadius) Bemisia tabaci با استفاده از تکنیک RNAi

نوع مقاله : علمی پژوهشی-فارسی

نویسندگان

1 استادیار دانشگاه جیرفت

2 استاد دانشگاه تهران

3 دانشیار دانشگاه تهران

4 استادیار دانشگاه تهران

چکیده

 سفیدبالک (Gennadius.)Bemisia tabaci یکی از مهمترین آفات گیاهان  زراعی و محصولات زینتی در جهان است و مشاهده شده است که  قابلیت مقاوم شدن به بسیاری از گرو ه‌های حشره‌کش‌ها را دارد. این آفت توانایی بروز مقاومت به گروه‌های مختلف حشره­کش از جمله نئونیکوتونوئیدها را دارا می­باشد.در مطالعه­ی حاضر تاثیر استفاده از تکنیک خاموشی ژن (RNAi) ژن CYP6CM1 به عنوان یکی از اصلی‌ترین ژن‌های مسئول بروز مقاومت به نئونیکوتینوئیدها روی سطح نسبی بیان، اندازه مقاومت و میزان فعالیت آنزیم سیتوکروم P450   در دو جمعیت  سفیدبالک پنبه مقاوم و حساس در برابر حشره‌کش ایمیداکلوپرید مورد ارزیابی قرار گرفت.کلنی جمعیت­های سفیدبالک پنبه روی برگ‌های گیاه گوجه و در اتاقک رشد پرورش یافت.  RNA  دو رشته‌ای ژن CYP6CM1 با استفاده از پرایمرهای اختصاصی سنتز شد و آزمایشات زیست‌سنجی پس از وارد کردن dsRNA به  داخل بدن حشره از طرق دریافت دهانی و با محاسبه مقدار LC50 و نسبت مقاومت با استفاده از نرم افزار کامپیوتری Ploplus انجام شد. اندازه‌گیری فعالیت مونواکسیژناز نیز با استفاده از زیر نهشت 7- اتوکسی کومارین انجام شد. آنالیز داده‌ها نشان داد که تغذیه دهانیdsRNA  به طور موثری میزان سطح بیان نسبی ژن CYP6CM1 (2 برابری)، اندازه مقاومت (3/5 برابری) و میزان فعالیت آنزیم سیتوکرومP450  (45 درصدی) را در جمعیت مقاوم تغذیه‌شده باCYP6CM1dsRNA کاهش داد. کاهش چند برابری اندازه مقاومت بیانگر امکان استفاده عملی از تکنیکRNAi  در مدیریت مقاومت  B. tabaci می‌باشد.

کلیدواژه‌ها

عنوان مقاله [English]

Silencing of CYP6CM1 gene of cotton whitefly Bemisia tabaci (Gennadius) using RNAi technique

نویسندگان [English]

  • M Basij 1
  • KH Talebi 2
  • V. Hosseininaveh 3
  • S. A Salami 4
1 Assistant Professor, University of Jiroft,
2 Professor, University of Tehran
3 Associate Professor, University of Tehran
4 Assistant Professor, University of Tehran
چکیده [English]

Background and Objectives
The cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a significant agricultural pest in arable lands and on ornamental crops in temperate regions of the world and has been shown to be capable of developing resistance to many classes of insecticides. Difficulties in controlling B. tabaci mainly result from its resistance to insecticides, including neonicotinoids. Neonicotinoids are a relatively new class of synthetic insecticides used primarily to control of whiteflies, B. tabaci is capable of developing resistance to different classes of insecticides as neonicotinoides. It has been experimentally proven that resistance of B. tabaci to imidacloprid is associated with overexpression of the P450 genes. RNA interference (RNAi) has been successfully applied in insects to study RNAi mechanisms and gene functions. In this study, the RNA interference (RNAi) effects of P450 CYP6CM1 as key gene in resistance to neonicotinoides on expression, resistance ratio and total P450 activities were evaluated.
Material and Methods
Colony of whitefly reared on leaves of tomato plants in growth chamber at 25 ± 2 ºC, 65±5% RH and a photoperiod 16:8 h (light: darkness). Total RNA was isolated from adult B. tabaci using Biosol reagent (Invitrogen). cDNA synthesis was performed using iScript cDNA Synthesis Kit (BIO-RAD). Double-stranded RNA (dsRNA) of P450 CYP6CM1 was synthesized using specific primers (3' TAATACGACTCACTATAGGG 5', 3' TAATACGACTCACTATAGGG 5'), the bioassay tests after introduce of dsRNA into the insect body of whitefly by oral delivery were carried out for 6 days, and mortality was recorded daily by counting the dead insects at the bottom of the tube. The LC50 and resistance ratio were calculated using Ploplus computer software. The amount of cytochrome P450 activity was measured using 7-ethoxycoumarin based on the microfluorimetric method. Quantification of mRNA expression levels was quantified using the comparative cross-threshold (CT) (the PCR cycle number that crosses the signal threshold) method.
Results
Analysis of knockdown effects of CYP6CM1 on resistance was based on probit analysis and indicates that the gene is responsible for up to 5.3-fold reduction in imidacloprid resistance of dsRNA-fed adults. Moderate, but significant reduction in total P450 activity (45 %) exhibited by microsomal proteins prepared from dsRNA-fed JR population adult when compared to the control (JR population without dsRNA-fed). The results of P450 CYP6CM1 mRNA expression levels showed decrease in mRNA levels of the target genes with increasing the time after feeding dsRNA. Results revealed that delivery dsRNA to adult insect's reduced CYP6CM1 expression up to 2 -fold when comparing to the control.
Discussion
Reduction in resistance ratio by 5.3 fold after CYP6CM1 dsRNA fed in resistance population indicated the possibility of practical use of RNAi technique in insect resistance management (IRM).

کلیدواژه‌ها [English]

  • Bemisia tabaci
  • imidacloprid
  • resistance to insecticide
  • gene silencing
  • CYP6CM1dsRNA

مراجع

Basij, M., Talebi, K., Ghadamyari, M., Hosseininaveh, V., and Salami, S. A. 2016. Status of Resistance of Bemisia tabaci (Hemiptera: Aleyrodidae) to Neonicotinoids in Iran and Detoxification by Cytochrome P450-Dependent Monooxygenases. Neotropical Entomology, 46(1): 115-124.
Bautista, M. A. M., Miyata, T., Miura, K., and Tanaka, T. 2009. RNA interference-mediated knockdown of a cytochrome P450, CYP6BG1, from the diamondback moth, Plutella xylostella, reduces larval resistance to permethrin. Insect Biochemistry Molecular Biology, 39: 38-46.
Bedford, I., Briddon, R. W., Brown, J. K., Rosell, R. C., and Markham, P. G. 1994. Geminivirus transmission and biological characterisation of Bemisia tabaci (Gennadius) biotypes from different geographic regions. Annals of Applied Biology, 125: 311–325.
De Barro, P. J., Liu, S., Boykin, L. M., and Dinsdale, A. B. 2011. Bemisia tabaci . A statement of Species Status. Annual Review of Entomology, 56:1-19.
Ghadamyari, M., Mizuno, H., Oh, S., Talebi, K., and Kono, Y. 2008. Studies on pirimicarb resistance mechanisms in Iranian populations of the peach-potato aphid, Myzus persicae. Applied Entomology and Zoology, 43(1): 149–157.
Ghanim, M., Kontsedalov, S., and Czosnek, H. 2007. Tissue-specific gene silencing by RNA interference in the whitefly Bemisia tabaci (Gennadius). Insect Biochemistry Molecular Biology, 37: 732-738.
Huvenne, H., and Smagghe, G. 2010. Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: a review. Journal of Insect Physiology, 56(3): 227-235.
James, D. G., and Price, T. S. 2002. Fecundity in two spottd spider mite (Acari: Tetranychidae) is increased by direct and systemic exposure to Imidacloprid. Journal of Economic Entomology, 95: 729–732.
Kumar, M., Gupta, G. P., and Rajam, M. V. 2009. Silencing of acetylcholin esterase gene of Helicoverp armigera by siRNA affects larval growth and its life cycle. Journal of Insect Physiology, 55: 273-278.
Legg, J. P., Shirima, R., Tajebe, L. S., Guastella, D., Boniface, S., Jeremiah, S., Nsami, E., Chikoti, P.,  and Rapisarda, C. 2014. Biology and management of Bemisia whitefly vectors of cassava virus pandemics in Africa. Pest Managment Science, 70:1446-1453.
Li, J., Li, X., Bai, R., Shi, Y., Tang, Q., An, S. H., Songb, Q., and Yana, F. 2014. RNA interference of the P450 CYP6CM1 gene has different efficacy in B and Q biotypes of Bemisia tabaci. Pest Management Science, 71: 1175–1181.
Livak, K. J., and Schmittgen, T. D.  2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods, 25:402-408.
Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. 1951. Protein Measurement with the Folin Phenol Reagent. Journal of Biological Chemistry, 193: 265-275.
Oliveira, M. R. V., Henneberry, T. J., and Anderson, P. 2001. History, current status, and collaborative research projects for Bemisia tabaci. Crop Protection, 20: 709-723.
Price, D. R., and Gatehouse, J. A. 2008. RNAi-mediated crop protection against insects. Trends in Biotechnology, 26: 393-400.
Robertson, J. L., and Preisler, K. 1992. Pesticide bioassay with arthropods. CRC Press, Inc., Boca Raton, Florida. 127p.
Scott, J. G. 1990. Investigating mechanisms of insecticide resistance: Methods, strategies and pitfalls. In: Pesticides resistance in arthropods, R. T. Roush and E. Tabashnik (Eds.). Chapman and hall Newyork and Landon. 39- 57.
Stumpf, N., and Nauen, R. 2002. Biochemical markers linked to abamectin resistance in Tetranychus urticae (Acari: Tetranychidae). Pesticide Biochemistry and Physiology, 72: 111-121.
Turner, C. T., Davy, M. W., Macdiarmid, R. M., Plummer, K. M., Birch, N. P., and Newcomb, R. D. 2006. RNA interference in the light brown apple moth, Epiphyas postvittana (Walker), induced by double-stranded RNA feeding. Insect Molecular Biology, 15: 383-391.
Yokomi, R. K., Hoelmer, K. A., and Osborne, L. S. 1990. Relationships between the sweet-potato whitefly and the squash silverleaf disorder. Phytopathology, 80: 895-900.
Upadhyay, S. K., Chandrashekar, K., Thakur, N., Verma, P. C., Borgio, J. F., and Singh, P. K. 2011. RNA interference for the control of whiteflies (Bemisia tabaci) by oral route. Journal of Biosciences, 36:153-161.
گیاه پزشکی
دوره 42، شماره 1
اردیبهشت 1398
صفحه 79-89

فایل ها

هم رسانی

ارجاع به این مقاله

آمار